Control and Limit Enforcements for VSC Multi-Terminal HVDC in Newton Power Flow

This paper proposes a novel method to automatically enforce controls and limits for Voltage Source Converter (VSC) based multi-terminal HVDC in the Newton power flow iteration process. A general VSC MT-HVDC model with primary PQ or PV control and secondary voltage control is formulated. Both the dependent and independent variables are included in the propose formulation so that the algebraic variables of the VSC MT-HVDC are adjusted simultaneously. The proposed method also maintains the number of equations and the dimension of the Jacobian matrix unchanged so that, when a limit is reached and a control is released, the Jacobian needs no re-factorization. Simulations on the IEEE 14-bus and Polish 9241-bus systems are performed to demonstrate the effectiveness of the method.Comment: IEEE PES General Meeting 201

Anthropogenically forced decadal change of South Asian summer monsoon across the mid‐1990s

Analysis of observations indicates that there was a significant decadal change in summer (June‐August) mean rainfall over South Asia and Southeast Asia across the mid‐1990s, which is characterized by less rainfall over central‐northern India and northern Indo‐China Peninsula. This study investigates impacts of anthropogenic forcing on the observed decadal change across the mid‐1990s. A set of experiments using the coupled atmosphere‐ocean‐mixed‐layer model MetUM‐GOML2 has been performed to quantify the relative roles of changes in anthropogenic greenhouse gases (GHG) and anthropogenic aerosols (AA). Results indicate a dominant role of anthropogenic changes in the observed decadal changes. Separately, the changes in GHG forcing play an important role in the reduction of rainfall over central‐northern India through the changes of atmospheric circulation (i.e. the local Hadley circulation and the Walker circulation), with additional contribution from changes in AA forcing. The changes in AA forcing dominate the reduction of rainfall over northern Indo‐China Peninsula due to high‐pressure anomalies over northern South Asia and the western subtropical Pacific. These high‐pressure anomalies are induced by the surface cooling mainly via aerosol‐radiation interaction that decreases downward clear sky shortwave radiation over South Asia during summer, and aerosol‐radiation interaction and aerosol‐cloud interaction that decrease downward shortwave radiation over the western subtropical Pacific during pre‐summer seasons

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells